I thought I'd cut and paste the summary here so I could refer to it when saying something about it. It is interesting and naturegirl, your daughter's summary is good.

*******
Edible fruits, such as that of the tomato plant and other vegetable crops, are markedly diverse in shape and size. SUN, one of the major genes controlling the elongated fruit shape of tomato, was positionally cloned and found to encode a member of the IQ67 domainÂcontaining family. We show that the locus arose as a result of an unusual 24.7-kilobase gene duplication event mediated by the long terminal repeat retrotransposon Rider. This event resulted in a new genomic context that increased SUN expression relative to that of the ancestral copy, culminating in an elongated fruit shape. Our discovery demonstrates that retrotransposons may be a major driving force in genome evolution and gene duplication, resulting in phenotypic change in plants.

*****

Basically it's saying that a transposon, which is a movable piece of DNA, sometimes called a jumping gene, can cause duplications in the DNA, such as:

Original DNA nucleotide sequence:

TTAGTCTAAGCGTAT ( my theoretical sequence)

to go to something like:

TTAGTCTAAGCGTAT ( duplicate the the terminal sequence b/c the Rider transposon causes terminal, not internal, repeats)

So it goes to comething like: TTAGTCTAAGCGTAT(CGTAT)
, thus duplicating the CGTAT region at the end

so that the sequence becomes: TTAGTCTAAGCTAAGCGTATCGTAT

And that DNA duplication when translated to messenger RNA and then expressed as protein can change the shape of a tomato fruit.

Jumping genes have been shown to occur almost eveywhere one looks for them in corn and many other veggies, and they're also responsible for several different kinds of antibiotic resistances in bacteria.

For those who might have forgotten the nucleotide DNA bases they are:

A=adenine
T=thymine
G=Guanine
C=Cytosine

So they're suggesting that over time and as tomatoes evolved and were domesticated that different transposons could cause DNA duplications that can alter the tomato genome and cause fruit shape changes and they mention the SUN gene, known to be associated with tomato length, as one example that can be changed by the transposon Rider.

Carolyn, who next time she eats a lucious homegrown tomato will NOT be thinking SUN and Rider. LOL

LOL, here I figured Carolyn might identify the tomato varieties in the picture but instead I get a genetics lesson. And that is good, too.

My daughter works with bacteria and viruses. She said that similar things occur alot in some of them and can make antibiotics and vaccines ineffective quickly. I'm glad the changes in tomatoes bring us interesting new varieties to eat instead of untreatable diseases.

I'm guessing transporon action in tomato pathogens may be causing challenges in controlling some tomatoe diseases. Next time I have diseased plants I'll be imagining little ATCG bases playing musical chairs and getting all jumbled up to complicate things even more.

LOL, here I figured Carolyn might identify the tomato varieties in the picture

*****

Are you kidding? LOL

Any one of those could be any number of varieties. LOL All they were trying to show was different shapes.

I knew you said you read through it twice and wasn't sure of what was happening, so I thought I'd try to outline for you and anyone else interested what was going on.

Carolyn